Overview
Porcine reproductive and respiratory syndrome is caused by porcine reproductive and respiratory syndrome virus caused by a contagious disease for various Porcine reproductive and respiratory syndrome is caused by porcine reproductive and respiratory syndrome virus caused by a contagious disease for various . pigs of younger ages may be infected, the clinical traits of reproductive failure in sow and piglet of respiratory symptoms as the main features of LPMCN pigs of younger ages may be infected, the clinical traits of reproductive failure in sow and piglet of respiratory symptoms as the main features of LPMCN .
Porcine Reproductive and Respiratory Syndrome, also called blue - ear epidemic abortion and respiratory syndrome virus as the causative pathogenic Porcine Reproductive and Respiratory Syndrome, also called blue - ear epidemic abortion and respiratory syndrome virus as the causative pathogenic . 1987 first reported in the United States, the 1991 Dutch scientists isolated the causative virus; thereafter across much of Europe's pig - raising, and has global trends 1987 first reported in the United States, the 1991 Dutch scientists isolated the causative virus; thereafter across much of Europe's pig - raising, and has global trends .
China in 1995 in Beijing after the occurrence of the disease,become non - prone zone 1 China in 1995 in Beijing after the occurrence of the disease,become non - prone zone 1 .
Route Of Infection
porcine virus disease is generally in direct contact with susceptible swine, by propagation, pig - pig infection after 42 days can be isolated from the salivary gland virus porcine virus disease is generally in direct contact with susceptible swine, by propagation, pig - pig infection after 42 days can be isolated from the salivary gland virus . PRRS virus can also be infected by intranasal, urine, semen detox weeks PRRS virus can also be infected by intranasal, urine, semen detox weeks .
is not entirely clear why the PRRS virus in porcine persisted a long time, while immune responses in swine which cannot effectively control the virus's replication is not entirely clear why the PRRS virus in porcine persisted a long time, while immune responses in swine which cannot effectively control the virus's replication . has been reported in pigs after infection 3 ~ 4 weeks inside the pig's immune system is unable to generate an effective immune response to PRRS virus has been reported in pigs after infection 3 ~ 4 weeks inside the pig's immune system is unable to generate an effective immune response to PRRS virus .
even resulted in a body of non - specific immune function decline even resulted in a body of non - specific immune function decline .
Virus Replication
The first step is the replication of virus adsorption with upper respiratory tract mucosa; subsequently, the virus begins to replicate within macrophages in the alveoli, the infected cells produced high titers of virus directly to cells dissolved The first step is the replication of virus adsorption with upper respiratory tract mucosa; subsequently, the virus begins to replicate within macrophages in the alveoli, the infected cells produced high titers of virus directly to cells dissolved . according the virulence of the viruses, the virus strain are IBDV infection after 1 ~ 2 weeks can reduce the damage of up to 50% according the virulence of the viruses, the virus strain are IBDV infection after 1 ~ 2 weeks can reduce the damage of up to 50% .
Because alveolar macrophages in the lung to infection by a microorganism plays an important role, its damaged resulting in swine populations susceptible to secondary infection Because alveolar macrophages in the lung to infection by a microorganism plays an important role, its damaged resulting in swine populations susceptible to secondary infection . infection after 3 weeks, macrophages in the lung generally renewable infection after 3 weeks, macrophages in the lung generally renewable .
virus replication are also in the occurrence of a localized inflammation characterized by mononuclear cell infiltration is alveolar septa,Such interstitial pneumonia with taupe virus replication are also in the occurrence of a localized inflammation characterized by mononuclear cell infiltration is alveolar septa,Such interstitial pneumonia with taupe . lesion feature, however, that the lesion may be due to other facultative bacteria of repeated infections complicate lesion feature, however, that the lesion may be due to other facultative bacteria of repeated infections complicate .
PRRS virus in porcine alveolar macrophage (AM) in the first round of replication, a large number of virus particles released into the blood circulation, per milliliter in the serum can be up to 1000 infectious viral particle PRRS virus in porcine alveolar macrophage (AM) in the first round of replication, a large number of virus particles released into the blood circulation, per milliliter in the serum can be up to 1000 infectious viral particle . in the peripheral blood circulation, the PRRS virus can infect the monocytes, and propagated to the various organizations within the system of mononuclear cells in the peripheral blood circulation, the PRRS virus can infect the monocytes, and propagated to the various organizations within the system of mononuclear cells .
pregnant in the last 3 days, the virus can pass through the placental barrier to infect the fetus, with the result that it is premature and stillborn pregnant in the last 3 days, the virus can pass through the placental barrier to infect the fetus, with the result that it is premature and stillborn . virus may also be in the middle of pregnancy the placenta barrier,But on the descendants of the relatively limited virus may also be in the middle of pregnancy the placenta barrier,But on the descendants of the relatively limited .
opposite, PRRS virus in early infection can lead to increased again opposite, PRRS virus in early infection can lead to increased again .
Virus Characteristic
PRRS virus is a non - segmented RNA virus, and 6 by structural proteins, each with different biological functions of some virus proteins (PRRS virus is a non - segmented RNA virus, and 6 by structural proteins, each with different biological functions of some virus proteins (. E. GP3) can induce immunity in pigs in generating a protective immune response, in contrast, although the N protein that is capable of pre - and post - vaccination in pigs earlier to detect high titer antibody responses, but is unable to protect pigs against viruses
in antibody formation and protection induced by the reaction between the difference of the future development of the tagged vaccine, serological test and to distinguish between vaccinated and wild virus infection according to in antibody formation and protection induced by the reaction between the difference of the future development of the tagged vaccine, serological test and to distinguish between vaccinated and wild virus infection according to . according to different separation of the pig virus genome and antigens,viruses are divided into two subsets of one subpopulation is mainly distributed in North America, another major European according to different separation of the pig virus genome and antigens,viruses are divided into two subsets of one subpopulation is mainly distributed in North America, another major European .
PRRS virus antigen on the two sub - groups of the resulting from the presence of the two actual result PRRS virus antigen on the two sub - groups of the resulting from the presence of the two actual result . is a group of viruses associated with virus infection of pigs only partial protection from the other virus strain of repeated infection is a group of viruses associated with virus infection of pigs only partial protection from the other virus strain of repeated infection .
. Secondly, if a pig can be subjected to another subpopulation of viral infection, for which a set of virus - specific antigen, antibody or nucleic acid probes of the other group of virus diagnosis possible false negative and 
Immunosuppressive Action
PRRS virus after the acute infection of pig farms often occurs secondary to infection, and can last weeks, this phenomenon with the pigs in the PRRS virus, or long lasting infection facts can usually considered as PRRS virus causes a porcine immunosuppressive PRRS virus after the acute infection of pig farms often occurs secondary to infection, and can last weeks, this phenomenon with the pigs in the PRRS virus, or long lasting infection facts can usually considered as PRRS virus causes a porcine immunosuppressive . dual infection of several test failed to confirm the PRRS virus and other pathogen interaction dual infection of several test failed to confirm the PRRS virus and other pathogen interaction .
PRRS virus and not to the clinical manifestations of PRRS virus and not to the clinical manifestations of . opposite, thought by some scholars to PRRS virus can increase the pathogenicity of influenza viruses and swine Streptococcus opposite, thought by some scholars to PRRS virus can increase the pathogenicity of influenza viruses and swine Streptococcus .
in these experiments, the PRRS virus after 3 ~ 7 days after inoculation of the second virus in these experiments, the PRRS virus after 3 ~ 7 days after inoculation of the second virus . In another study,14 days after inoculation with PRRS virus infection, influenza infection as compared with the individual, without an increase in the incidence of infection from the PRRS virus may be preliminary In another study,14 days after inoculation with PRRS virus infection, influenza infection as compared with the individual, without an increase in the incidence of infection from the PRRS virus may be preliminary .
think youth in an unvaccinated susceptible herd there think youth in an unvaccinated susceptible herd there . long term repetitively during the acute phase of infection, due to the destruction of alveolar macrophages, young pigs increased susceptibility to secondary infection of the respiratory tract, thus excluding a lot of contamination around the pig virus, sheds and other pigs resulting in repeated infections, particularly in stocking density is too large when the situation is aggravated by the long term repetitively during the acute phase of infection, due to the destruction of alveolar macrophages, young pigs increased susceptibility to secondary infection of the respiratory tract, thus excluding a lot of contamination around the pig virus, sheds and other pigs resulting in repeated infections, particularly in stocking density is too large when the situation is aggravated by the .
this batch of burdens, and thereby secondary infection can explain the causes of persistent this batch of burdens, and thereby secondary infection can explain the causes of persistent . 2 2.
Diagnosis
alveolar macrophage culture can be used from the infected swine serum separation in 1996.It at different intervals, from the same infection in swine which were collected for detecting the presence of the virus in the porcine death of at different intervals, from the same infection in swine which were collected for detecting the presence of the virus in the porcine death of .
lung, tonsil, lymph knot etc. ,and many organization capable of virus isolates ( with PRRS virus - specific monoclonal antibody and probe can be fixed in a direct and fast detection of the virus, but it is also possible to employ a polymerase chain reaction (PCR) method to detect virus genome with PRRS virus - specific monoclonal antibody and probe can be fixed in a direct and fast detection of the virus, but it is also possible to employ a polymerase chain reaction (PCR) method to detect virus genome .
all these virological methods having different sensitivity,generally considered separate virus cell culture and polymerase chain reaction method is the most sensitive technologies all these virological methods having different sensitivity,generally considered separate virus cell culture and polymerase chain reaction method is the most sensitive technologies . But it is a disadvantage that these methods cannot be used for detection and diagnosis of large - scale conventional But it is a disadvantage that these methods cannot be used for detection and diagnosis of large - scale conventional .
Furthermore, infecting and detection of serum antibodies after diagnosis of PRRS virus is an economical and reliable method of Furthermore, infecting and detection of serum antibodies after diagnosis of PRRS virus is an economical and reliable method of . now has founded a number of experiments, monolayers of cells, including immuno - peroxidase test, immunofluorescence test, ELISA, neutralization test now has founded a number of experiments, monolayers of cells, including immuno - peroxidase test, immunofluorescence test, ELISA, neutralization test .
available serum and colostrum anti - PRRS virus antibody detection available serum and colostrum anti - PRRS virus antibody detection . Poison In order to demonstrate the acute infection, and convalescent sera collected 3 weeks apart, according to their serum antibody change,so as to lead to a clear diagnosis Poison In order to demonstrate the acute infection, and convalescent sera collected 3 weeks apart, according to their serum antibody change,so as to lead to a clear diagnosis .
Molecular Biology Diagnosis
RT - PCR Diagnostic Method: PRRS disease (lung, lymph node tissue grinding): Application of TRIZOL cell lysate was subjected to a conventional method. The extracted RNA was reverse - transcribed downstream primer; reverse transcription product (cDNA samples were amplified by PCR using the upstream primer 5 GCGGATCCATGCGATCTAACAAC3; downstream primer 5 AGCGCGAGTCAGGCTAGGGAGGA3), PCR reaction condition was: 94 # pre - denature for 3min at 94 C denaturation for 1min, 1min 53 deg.c,72 C 1 min, 30 cycles, 72 C for 2 min after the completion of the reaction, 5. mu. L of PCR product in 1% agarose gel electrophoresis results
amplicon was around 417bp. This fragment with expected size of amplified fragment consistent 417bp 417bp.
Serological Diagnosis
use of animal virus which has been developed by Huazhong Agriculture University Animal Hospital of blue - ear pig disease antibody detecting reagent kit for detecting 10 use of animal virus which has been developed by Huazhong Agriculture University Animal Hospital of blue - ear pig disease antibody detecting reagent kit for detecting 10 . serologic tests was carried out by killing infected serum sample with a dilution of 1: 40 dilution, added to each well to 100gL; with dilution of 1: 4 dilution of the female, a positive control, each with 2 holes, each hole 100. mu. L; and is further formed with a hole for the placebo, added with 100. m u.L of the diluent
incubation at 37.d egree. C. for 30 min, dumped a plate in a solution, and washed 5 times with washing solution, added to each well of the enzyme - labeled bi - 100. mu. L, incubation at 37.d egree. C. for 30 min then washed ,adding colour developing liquid color ,adding colour developing liquid color .
measured for the specimen of the OD630 values respectively: 0, 0.44, 0.46, and 0.50, 0.48, 0.46 mm, 0.52, 0.55, 0.49, 0.53, 0. 47 measured value is larger than 0. 42 can be determined as positive, and hence it is possible to diagnosis the disease is porcine reproductive and respiratory syndrome virus (PRRSV)
The Suitable Rearing Density
In different areas, the prevalence of the disease have a In different areas, the prevalence of the disease have a . not according to different rearing density of pig populations there will be two million casualties, in high density region, the introduction of the PRRS virus typically results in a rapid fashion, within a few months the herd infection rates can be as high as 50% ~ 70% density not according to different rearing density of pig populations there will be two million casualties, in high density region, the introduction of the PRRS virus typically results in a rapid fashion, within a few months the herd infection rates can be as high as 50% ~ 70% density .
in the rearing area, as the virus spreads slowly, even in the absence of a propagating in the rearing area, as the virus spreads slowly, even in the absence of a propagating . in these areas, simple controls, namely being able to prevent the spread of the virus, if the phase - out to clear the infection in swine herds,may be successfully purify the disease in these areas, simple controls, namely being able to prevent the spread of the virus, if the phase - out to clear the infection in swine herds,may be successfully purify the disease .
to the horizontal purifying hogpen of PRRS virus, there are many ways to measure success using to the horizontal purifying hogpen of PRRS virus, there are many ways to measure success using . first requires no pigs in the PRRS virus propagation first requires no pigs in the PRRS virus propagation .
followed, part or all of the culling is to stop the virus in pigs and young pigs between propagation method of one of the followed, part or all of the culling is to stop the virus in pigs and young pigs between propagation method of one of the . although this method cannot completely eliminate the virus, but is generally able to improve the sanitary conditions and improving the economic benefit of although this method cannot completely eliminate the virus, but is generally able to improve the sanitary conditions and improving the economic benefit of .
Clinical Symptoms
Sow
sows infected during the first month of the clinical symptoms for a short period of anorexia, for 7 ~ 14 days, 10 ~ 15% of sows and the manifestations of the sows infected during the first month of the clinical symptoms for a short period of anorexia, for 7 ~ 14 days, 10 ~ 15% of sows and the manifestations of the . RT was elevated to 3940oC RT was elevated to 3940oC .
abortion, usually as the third trimester of pregnancy, which is the proportion of from 1 to 6% abortion, usually as the third trimester of pregnancy, which is the proportion of from 1 to 6% . This is normally first discovered symptom This is normally first discovered symptom .
ear brief discoloration (2% of sows may be observed that blue - ear disease) have a slightly premature ear brief discoloration (2% of sows may be observed that blue - ear disease) have a slightly premature . of of .
sows infected four weeks before and 10 to 15% occur after 21 sows infected four weeks before and 10 to 15% occur after 21 . ~ 35 days and unfortunately ~ 35 days and unfortunately .
anestrus, after weaning to estrus of prolonged respiratory symptoms such as cough anestrus, after weaning to estrus of prolonged respiratory symptoms such as cough . .
farrowing sows infected during the first month of symptoms:puerperal anorexia not drinking farrowing sows infected during the first month of symptoms:puerperal anorexia not drinking . .
agalactia and mastitis - symptoms significantly agalactia and mastitis - symptoms significantly . Chang 2 ~ 3 days of childbirth Chang 2 ~ 3 days of childbirth .
skin discoloration, tenderness, and have a small herpetic symptoms of respiratory depression skin discoloration, tenderness, and have a small herpetic symptoms of respiratory depression . .
. .
mummified 10 ~ 15% embryos died in 3 ~ 4 weeks pregnancy last mummified 10 ~ 15% embryos died in 3 ~ 4 weeks pregnancy last . stillborn piglets is to be increased to 30% stillborn piglets is to be increased to 30% .
gave birth to a very weak piglets gave birth to a very weak piglets . at the beginning of anorexia and body temperature normally lasts 3 - 6 weeks at the beginning of anorexia and body temperature normally lasts 3 - 6 weeks .
time less than 5% of the sows' ears, it's going to show white or blue of the symptoms, and symptoms vary greatly in a short - lived, and probably only a few hours time less than 5% of the sows' ears, it's going to show white or blue of the symptoms, and symptoms vary greatly in a short - lived, and probably only a few hours . some sows will cough,individual sow will exhibit symptoms of acute pneumonia some sows will cough,individual sow will exhibit symptoms of acute pneumonia .
phase lasts six weeks, is characterized by premature birth, stillbirth, weak, and after three weeks of pregnancy due to the death of the formation of phase lasts six weeks, is characterized by premature birth, stillbirth, weak, and after three weeks of pregnancy due to the death of the formation of . Large mummified pigs are pigs, piglets can be these component accounted for 30% of the proportion of Large mummified pigs are pigs, piglets can be these component accounted for 30% of the proportion of .
onset after 3 weeks or 4 weeks piglet mortality peak of up to 70%, 8 ~ 12 weeks later can restore the affected the levels before the onset after 3 weeks or 4 weeks piglet mortality peak of up to 70%, 8 ~ 12 weeks later can restore the affected the levels before the . concerning reproduction in so far as the problems persisted for 4 ~ 8 months, after the return to normal only concerning reproduction in so far as the problems persisted for 4 ~ 8 months, after the return to normal only .
But when a herd may be restored to the former is better than sick of level But when a herd may be restored to the former is better than sick of level . PRRS reproductive efficiency of long - term impact of the bad evaluation,especially when it comes to the health of the herd for PRRS reproductive efficiency of long - term impact of the bad evaluation,especially when it comes to the health of the herd for .
have pigs would return there is an increase in the number of breeding, vaginal prolapse and abortion issues, these are probably related to PRRS and have pigs would return there is an increase in the number of breeding, vaginal prolapse and abortion issues, these are probably related to PRRS and . under the production conditions are observed, the PRRS disease during the 12 months after a local infection on swine reproductive performance are as follows: 10 ~ 15% of the sows' parturition rate exhibit decreased 90% (normal) under the production conditions are observed, the PRRS disease during the 12 months after a local infection on swine reproductive performance are as follows: 10 ~ 15% of the sows' parturition rate exhibit decreased 90% (normal) .
. reduced number born alive, still births and a decrease in the number of first - litter sow reproductive performance poor reduced number born alive, still births and a decrease in the number of first - litter sow reproductive performance poor .
. .
the increase in the proportion of premature abortion (2 ~ 3%) anorexia the increase in the proportion of premature abortion (2 ~ 3%) anorexia . parturition in sows parturition in sows.
Piglets
diarrhea cases increased in diarrhea cases increased in . .
weak increase respiratory infections, such as, quote, "Lacey's boar weak increase respiratory infections, such as, quote, "Lacey's boar . .
anorexia symptoms of fever, lassitude, loss of libido, loss of anorexia symptoms of fever, lassitude, loss of libido, loss of . .
. .
the litter showed that the rate was decreased sperm levels fall the litter showed that the rate was decreased sperm levels fall . .
Weaning Piglets And Growing Pigs
there is no enzootic pneumonia (EP) and Actinobacillus pleuropneumoniae (App) of the growth of the group of primary exposure to the virus will exhibit the following symptoms: For the mild anorexia there is no enzootic pneumonia (EP) and Actinobacillus pleuropneumoniae (App) of the growth of the group of primary exposure to the virus will exhibit the following symptoms: For the mild anorexia . mild cough sometimes don't show any symptoms of mild cough sometimes don't show any symptoms of .
in the EP and / or App exist but under control of the infecting and PRRS after performance of the following symptoms: widespread and acute,a serious form of pneumonia in abscess site many in the EP and / or App exist but under control of the infecting and PRRS after performance of the following symptoms: widespread and acute,a serious form of pneumonia in abscess site many . .
weaned after 1 ~ 3 week - old fetuses and body condition and decreased incidence of weaned after 1 ~ 3 week - old fetuses and body condition and decreased incidence of . .
. .
pale skin visible diarrhea and mild cough and sneeze, ocular secretions out pale skin visible diarrhea and mild cough and sneeze, ocular secretions out . .
. .
breathing faster onset stage may have a mortality rate of 12 ~ 15% breathing faster onset stage may have a mortality rate of 12 ~ 15% . after acute onset after PRRS virus in swine herd of the population will decrease, causes only the early onset of growing pigs: severe pneumonia of after acute onset after PRRS virus in swine herd of the population will decrease, causes only the early onset of growing pigs: severe pneumonia of .
. .
staged anorexia consumed after disappearance of maternal antibodies in piglets infected by the disease, after 3 ~ 4 weeks in viral infection period, and will continue to release virus staged anorexia consumed after disappearance of maternal antibodies in piglets infected by the disease, after 3 ~ 4 weeks in viral infection period, and will continue to release virus . 4 12 - week old piglets may manifest clinical symptoms:Anorexia defective absorption of nutrients from consumed 4 12 - week old piglets may manifest clinical symptoms:Anorexia defective absorption of nutrients from consumed .
. .
cough pneumonia in post - weaning mortality in this stage will be raised to 12% or higher, and will keep the same level, even with antibiotics to treat or improve cough pneumonia in post - weaning mortality in this stage will be raised to 12% or higher, and will keep the same level, even with antibiotics to treat or improve . thereafter in 12 ~ 16 weeks other visible secondary infection of disease thereafter in 12 ~ 16 weeks other visible secondary infection of disease .
pulmonary abscess, and may spread throughout the body limp pulmonary abscess, and may spread throughout the body limp ., , .
. the slow growth of abscess the slow growth of abscess.
Nosogenesis
The following are the common transmission mode and the influencing factor: high - dayold pigs through droplet spread to low - dayold pigs The following are the common transmission mode and the influencing factor: high - dayold pigs through droplet spread to low - dayold pigs . nasal secretions, saliva, feces and urine, nasal secretions, saliva, feces and urine, .
homes empty for long time use of the pigsty was" the pigsty disinfection among viral levels can be very high, especially the 1st and 2nd stage of Nurseries in pigs, the virus carrying homes empty for long time use of the pigsty was" the pigsty disinfection among viral levels can be very high, especially the 1st and 2nd stage of Nurseries in pigs, the virus carrying . .
transfer air Transmission (3 km) transfer air Transmission (3 km) . through feces, dust, droplets and contaminated instruments produce mechanical transmission via through feces, dust, droplets and contaminated instruments produce mechanical transmission via .
contamination of their boots and clothes contamination of their boots and clothes . via vehicle, especially in cold weather via vehicle, especially in cold weather .
artificial insemination this propagation of with the proviso that the boars in viral infection period of adult short artificial insemination this propagation of with the proviso that the boars in viral infection period of adult short . detoxification period (14 days),Growing Pigs detox for a long period (1 ~ 2 months) detoxification period (14 days),Growing Pigs detox for a long period (1 ~ 2 months) .
ducks and other birds that may be carrying the virus 4 ducks and other birds that may be carrying the virus 4 .
Treatment Method
medicine medicine . Multipurpose broad - spectrum antibiotic to prevent complicating secondary bacterial infection or Multipurpose broad - spectrum antibiotic to prevent complicating secondary bacterial infection or .
aspirin tablets, oral tablet (3 ~ 4 0.5 g), 2 ~ 3 times a day, to reduce respiratory infections the efficacy trial Moroxydine and Banlangen injection injection, seems to alleviate the symptoms and can continue to expand test Moroxydine and Banlangen injection injection, seems to alleviate the symptoms and can continue to expand test .
adopt the Chinese herbal medicine radix isatidis, folium isatidis, herba Andrographitis, flos Lonicerae, oriental wormwood, knotweed, cyrtomium rhizome 30g, decoct juice or ground into fine powder and mixed with a small amount of feed to piglets and fattening pigs orally can relieve the symptoms and shorten the course and play a certain role in the adopt the Chinese herbal medicine radix isatidis, folium isatidis, herba Andrographitis, flos Lonicerae, oriental wormwood, knotweed, cyrtomium rhizome 30g, decoct juice or ground into fine powder and mixed with a small amount of feed to piglets and fattening pigs orally can relieve the symptoms and shorten the course and play a certain role in the .
Preventive Measures
prevention of the diseases are the major measures to clear the infection and cut off the route of transmission, improve the disease resistance and other comprehensive measures to eliminate the infectious prevention of the diseases are the major measures to clear the infection and cut off the route of transmission, improve the disease resistance and other comprehensive measures to eliminate the infectious .: a sick or sow should be eliminated; infection whereas the rehabilitation group, the ring should be specifically breeding, fattening and slaughter thick utensils should be thoroughly disinfected, with an interval of 1 ~ 2 months after the re - use; the disease has infected boars should resolutely eliminate : a sick or sow should be eliminated; infection whereas the rehabilitation group, the ring should be specifically breeding, fattening and slaughter thick utensils should be thoroughly disinfected, with an interval of 1 ~ 2 months after the re - use; the disease has infected boars should resolutely eliminate .
ector: establish proper disinfection, quarantine measures, disinfecting, sterilizing and no blind spot ector: establish proper disinfection, quarantine measures, disinfecting, sterilizing and no blind spot . pigsty should be well ventilated, often spraying, disinfecting, preventing disease of airborne pigsty should be well ventilated, often spraying, disinfecting, preventing disease of airborne .
immunity, strengthen nutrition to improve the resistance to: improve the welfare of pigs,given nutrition of the feed, without moldy feed, a feed supplemented with 0. 5% of private health - care pig large sturdy; fix the vaccination, immunization during feed supplemented with 1% of the pro - face No. 1, in order to improve the immunity level 5 

